Transcript: Mouse XM_006500273.2

PREDICTED: Mus musculus acyl-Coenzyme A oxidase-like (Acoxl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acoxl (74121)
Length:
5145
CDS:
62..2029

Additional Resources:

NCBI RefSeq record:
XM_006500273.2
NBCI Gene record:
Acoxl (74121)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076769 GCTGGTACTTAGAACATAAAT pLKO.1 1782 CDS 100% 15.000 21.000 N Acoxl n/a
2 TRCN0000076768 GCGAGAAATTTAGTGTCCCAT pLKO.1 2035 3UTR 100% 2.640 3.696 N Acoxl n/a
3 TRCN0000076770 CCAACTCATCATTGAGGGAAA pLKO.1 640 CDS 100% 4.050 3.240 N Acoxl n/a
4 TRCN0000435087 AGAACCTGCTGGATAAGTTTG pLKO_005 813 CDS 100% 10.800 7.560 N ACOXL n/a
5 TRCN0000076771 CATGTCTATAAAGTGTGGAAT pLKO.1 355 CDS 100% 4.950 3.465 N Acoxl n/a
6 TRCN0000076772 TGAAGATCATTGAGCACCAAA pLKO.1 1032 CDS 100% 4.950 3.465 N Acoxl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.