Transcript: Mouse XM_006500310.3

PREDICTED: Mus musculus tetratricopeptide repeat domain 17 (Ttc17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc17 (74569)
Length:
5667
CDS:
1224..4697

Additional Resources:

NCBI RefSeq record:
XM_006500310.3
NBCI Gene record:
Ttc17 (74569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155667 CCAGGTCAAACGTGTAAAGAA pLKO.1 3791 CDS 100% 5.625 7.875 N TTC17 n/a
2 TRCN0000265303 TGGGTTTGAGCAAGCTATAAA pLKO_005 2078 CDS 100% 15.000 10.500 N Ttc17 n/a
3 TRCN0000323402 TGGGTTTGAGCAAGCTATAAA pLKO_005 2078 CDS 100% 15.000 10.500 N TTC17 n/a
4 TRCN0000257896 CAATATGTTGAAGTCCTATAT pLKO_005 5361 3UTR 100% 13.200 9.240 N Ttc17 n/a
5 TRCN0000249450 CTAGAGCTTCCATATAGTATA pLKO_005 1590 CDS 100% 13.200 9.240 N Ttc17 n/a
6 TRCN0000257906 GACATTGCTCTGGTCAATTTG pLKO_005 1884 CDS 100% 13.200 9.240 N Ttc17 n/a
7 TRCN0000249451 CCGTGACTCTGATGCGTATAG pLKO_005 2558 CDS 100% 10.800 7.560 N Ttc17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.