Transcript: Mouse XM_006500411.2

PREDICTED: Mus musculus ninein-like (Ninl), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ninl (78177)
Length:
3947
CDS:
57..3218

Additional Resources:

NCBI RefSeq record:
XM_006500411.2
NBCI Gene record:
Ninl (78177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114695 CCTGAACGATTATGAGCTTAA pLKO.1 1721 CDS 100% 10.800 15.120 N Ninl n/a
2 TRCN0000364672 GGTTAACTTTGAGGAATTTAA pLKO_005 257 CDS 100% 15.000 10.500 N NINL n/a
3 TRCN0000114692 CCCTTGACAATGAACTGCTAA pLKO.1 1156 CDS 100% 4.950 3.465 N Ninl n/a
4 TRCN0000114691 GCAAAGAACAATGGAGAGAAA pLKO.1 3484 3UTR 100% 4.950 3.465 N Ninl n/a
5 TRCN0000114693 GCCCTTGACAATGAACTGCTA pLKO.1 1155 CDS 100% 2.640 1.848 N Ninl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.