Transcript: Mouse XM_006500551.2

PREDICTED: Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 4 (Chrna4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chrna4 (11438)
Length:
4445
CDS:
164..2002

Additional Resources:

NCBI RefSeq record:
XM_006500551.2
NBCI Gene record:
Chrna4 (11438)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103021 CCGGAGACTTATCGAATCCAT pLKO.1 1222 CDS 100% 3.000 4.200 N Chrna4 n/a
2 TRCN0000103020 GCAGAATGAAAGAAGAACTTA pLKO.1 3300 3UTR 100% 5.625 3.938 N Chrna4 n/a
3 TRCN0000103023 CACCTACAACACCAGGAAGTA pLKO.1 766 CDS 100% 4.950 3.465 N Chrna4 n/a
4 TRCN0000103024 CCAGTAGCCAATATCTCAGAT pLKO.1 278 CDS 100% 4.950 3.465 N Chrna4 n/a
5 TRCN0000103022 CGGAGTATCCAGTACTGTGTT pLKO.1 1580 CDS 100% 4.950 3.465 N Chrna4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.