Transcript: Mouse XM_006500591.1

PREDICTED: Mus musculus solute carrier family 17, member 9 (Slc17a9), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc17a9 (228993)
Length:
2077
CDS:
98..1243

Additional Resources:

NCBI RefSeq record:
XM_006500591.1
NBCI Gene record:
Slc17a9 (228993)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102021 GCCCGTCTGTACTGTTGCCAT pLKO.1 164 CDS 100% 0.880 1.232 N Slc17a9 n/a
2 TRCN0000102023 TGGTATCGTGCTCAGCAGCTT pLKO.1 218 CDS 100% 2.640 2.112 N Slc17a9 n/a
3 TRCN0000102020 CCTTCCTGACATTCTCTCGAA pLKO.1 388 CDS 100% 2.640 1.848 N Slc17a9 n/a
4 TRCN0000102022 CTGGACAGGAATCCTGCTCCT pLKO.1 107 CDS 100% 0.720 0.504 N Slc17a9 n/a
5 TRCN0000102024 CGGCAGCAGAGGATACACGGT pLKO.1 64 5UTR 100% 0.000 0.000 N Slc17a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.