Transcript: Mouse XM_006500603.1

PREDICTED: Mus musculus glucocorticoid modulatory element binding protein 2 (Gmeb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gmeb2 (229004)
Length:
4717
CDS:
791..2383

Additional Resources:

NCBI RefSeq record:
XM_006500603.1
NBCI Gene record:
Gmeb2 (229004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427222 TGACAAGGTCTGCTCTAATAC pLKO_005 1291 CDS 100% 13.200 18.480 N Gmeb2 n/a
2 TRCN0000428449 ATCGTTCCCGGGAACAGTATG pLKO_005 1707 CDS 100% 10.800 8.640 N Gmeb2 n/a
3 TRCN0000424347 TTCCATCTGTTGCTTATTAAT pLKO_005 2629 3UTR 100% 15.000 10.500 N Gmeb2 n/a
4 TRCN0000232267 AGCTCAAGGAAGCCGTGTTAG pLKO_005 999 CDS 100% 10.800 7.560 N GMEB2 n/a
5 TRCN0000096544 CGGATGAATCAAGAGAAGAAA pLKO.1 2525 3UTR 100% 5.625 3.938 N Gmeb2 n/a
6 TRCN0000096547 GCAGCACGAAGATTGACCTTT pLKO.1 1317 CDS 100% 4.950 3.465 N Gmeb2 n/a
7 TRCN0000096545 GCAGTCCTACATCCACAGAAT pLKO.1 1359 CDS 100% 4.950 3.465 N Gmeb2 n/a
8 TRCN0000096548 CACAGTCTGCACAGATTGCTT pLKO.1 1920 CDS 100% 3.000 2.100 N Gmeb2 n/a
9 TRCN0000096546 GCACCATTGTGACAATGCCTA pLKO.1 2283 CDS 100% 2.640 1.848 N Gmeb2 n/a
10 TRCN0000415249 ACAGCAGAGCTAACCTCATTT pLKO_005 1083 CDS 100% 13.200 7.920 N Gmeb2 n/a
11 TRCN0000016988 CCATTGGAGATGACACATTTA pLKO.1 1473 CDS 100% 13.200 9.240 N GMEB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.