Transcript: Mouse XM_006500652.3

PREDICTED: Mus musculus transcription factor-like 5 (basic helix-loop-helix) (Tcfl5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcfl5 (277353)
Length:
2218
CDS:
114..1586

Additional Resources:

NCBI RefSeq record:
XM_006500652.3
NBCI Gene record:
Tcfl5 (277353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085069 CGCAGAGTTCTAGTAACTCAT pLKO.1 907 CDS 100% 0.495 0.693 N Tcfl5 n/a
2 TRCN0000426724 GATGAAGACATCTTGATAATT pLKO_005 1788 3UTR 100% 15.000 10.500 N Tcfl5 n/a
3 TRCN0000418148 CAGTCTCATGGTACTCTATTG pLKO_005 2040 3UTR 100% 10.800 7.560 N Tcfl5 n/a
4 TRCN0000085068 CGACACCATCATGTGTTCTTA pLKO.1 1831 3UTR 100% 5.625 3.938 N Tcfl5 n/a
5 TRCN0000085071 CAAGAGATTGAGTCCACCAAA pLKO.1 996 CDS 100% 4.950 3.465 N Tcfl5 n/a
6 TRCN0000085070 CGGAGACAGATAAAGCAACAA pLKO.1 1378 CDS 100% 4.950 3.465 N Tcfl5 n/a
7 TRCN0000085072 GTTTGGATTAAAGTGGGAGAA pLKO.1 1056 CDS 100% 4.050 2.835 N Tcfl5 n/a
8 TRCN0000014610 CCGCATTTGCTGTGATGAGTT pLKO.1 1331 CDS 100% 4.950 3.465 N TCFL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500652.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.