Transcript: Mouse XM_006500670.2

PREDICTED: Mus musculus cadherin-like 26 (Cdh26), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh26 (381409)
Length:
2749
CDS:
343..2331

Additional Resources:

NCBI RefSeq record:
XM_006500670.2
NBCI Gene record:
Cdh26 (381409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094146 CCAAGGGTTGTTAAGTATTAT pLKO.1 963 CDS 100% 15.000 21.000 N Cdh26 n/a
2 TRCN0000094145 CGGTCGATTTGGACCAAGAAA pLKO.1 530 CDS 100% 5.625 4.500 N Cdh26 n/a
3 TRCN0000094148 CCAGGGTTGTGACACTTTCTT pLKO.1 1989 CDS 100% 5.625 3.938 N Cdh26 n/a
4 TRCN0000094144 CTTGGGAAACATCTGGGAGAT pLKO.1 2440 3UTR 100% 4.050 2.835 N Cdh26 n/a
5 TRCN0000094147 CCCAGTTTCCTGAGAAGGAAT pLKO.1 452 CDS 100% 0.495 0.347 N Cdh26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.