Transcript: Mouse XM_006500912.2

PREDICTED: Mus musculus ATP-binding cassette, sub-family A (ABC1), member 4 (Abca4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abca4 (11304)
Length:
5685
CDS:
105..5600

Additional Resources:

NCBI RefSeq record:
XM_006500912.2
NBCI Gene record:
Abca4 (11304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440757 CCGGAGTACCCATGCATTAAT pLKO_005 4452 CDS 100% 15.000 21.000 N Abca4 n/a
2 TRCN0000436638 GGCGGATCCTGTCGAAGATTT pLKO_005 1886 CDS 100% 13.200 18.480 N Abca4 n/a
3 TRCN0000113473 CCCGCCTATTCTTACGACAAA pLKO.1 1176 CDS 100% 4.950 6.930 N Abca4 n/a
4 TRCN0000113472 CGTCTGAACATCACTTTCTAT pLKO.1 2946 CDS 100% 5.625 4.500 N Abca4 n/a
5 TRCN0000421261 CAACTTCCTCTGGGATATTAT pLKO_005 5279 CDS 100% 15.000 10.500 N Abca4 n/a
6 TRCN0000113471 CCTGGATGTATGGGCATCAAT pLKO.1 4321 CDS 100% 5.625 3.938 N Abca4 n/a
7 TRCN0000113474 GCTGATGATATGACCAGCTTT pLKO.1 1575 CDS 100% 4.950 3.465 N Abca4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.