Transcript: Mouse XM_006500925.2

PREDICTED: Mus musculus synaptopodin 2 (Synpo2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Synpo2 (118449)
Length:
4071
CDS:
163..3399

Additional Resources:

NCBI RefSeq record:
XM_006500925.2
NBCI Gene record:
Synpo2 (118449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175254 CCCAAGTTGTGAACTTTGATT pLKO.1 1511 CDS 100% 5.625 4.500 N Synpo2 n/a
2 TRCN0000175071 GAAGAAGACTACCTCAGTTTA pLKO.1 2326 CDS 100% 13.200 9.240 N Synpo2 n/a
3 TRCN0000175980 GCACCCACACCATTAGTAAAT pLKO.1 2677 CDS 100% 13.200 9.240 N Synpo2 n/a
4 TRCN0000193501 GAGATAAGTGAGGTTGCATTT pLKO.1 1432 CDS 100% 10.800 7.560 N Synpo2 n/a
5 TRCN0000176332 CAACACCCAAGTTGTGAACTT pLKO.1 1506 CDS 100% 4.950 3.465 N Synpo2 n/a
6 TRCN0000174014 CCCTCAGAAGTCAACAGTCAA pLKO.1 3105 CDS 100% 4.950 3.465 N Synpo2 n/a
7 TRCN0000193589 GCCTTCTATGATTCATCTGAA pLKO.1 2113 CDS 100% 4.950 3.465 N Synpo2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.