Transcript: Mouse XM_006500962.2

PREDICTED: Mus musculus complement component factor i (Cfi), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cfi (12630)
Length:
2063
CDS:
83..1873

Additional Resources:

NCBI RefSeq record:
XM_006500962.2
NBCI Gene record:
Cfi (12630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369978 CCATGGCAGGTGGCAATTAAG pLKO_005 1178 CDS 100% 13.200 18.480 N CFI n/a
2 TRCN0000031552 CCATATCTGTTCCAACCGAAT pLKO.1 1493 CDS 100% 4.050 5.670 N Cfi n/a
3 TRCN0000334627 CCATATCTGTTCCAACCGAAT pLKO_005 1493 CDS 100% 4.050 5.670 N Cfi n/a
4 TRCN0000031553 CCAGACCAATACAAGTGTAAT pLKO.1 914 CDS 100% 13.200 10.560 N Cfi n/a
5 TRCN0000334700 CCAGACCAATACAAGTGTAAT pLKO_005 914 CDS 100% 13.200 10.560 N Cfi n/a
6 TRCN0000031551 CCTTAATTTATGGGAGAACAA pLKO.1 435 CDS 100% 4.950 3.960 N Cfi n/a
7 TRCN0000031550 CGGCTTTATTAGACTGGCTAA pLKO.1 1305 CDS 100% 4.050 2.835 N Cfi n/a
8 TRCN0000334701 CGGCTTTATTAGACTGGCTAA pLKO_005 1305 CDS 100% 4.050 2.835 N Cfi n/a
9 TRCN0000031549 CCTCCTTCTTTCTACATTTAT pLKO.1 1882 3UTR 100% 15.000 9.000 N Cfi n/a
10 TRCN0000334703 CCTCCTTCTTTCTACATTTAT pLKO_005 1882 3UTR 100% 15.000 9.000 N Cfi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.