Transcript: Mouse XM_006501031.3

PREDICTED: Mus musculus major facilitator superfamily domain containing 14A (Mfsd14a), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mfsd14a (15247)
Length:
2629
CDS:
211..1404

Additional Resources:

NCBI RefSeq record:
XM_006501031.3
NBCI Gene record:
Mfsd14a (15247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102122 CGGAACACACTAATTTAAGTT pLKO.1 1392 CDS 100% 5.625 7.875 N Mfsd14a n/a
2 TRCN0000309008 CGGAACACACTAATTTAAGTT pLKO_005 1392 CDS 100% 5.625 7.875 N Mfsd14a n/a
3 TRCN0000413149 TTATACCTCAGACAGATAATG pLKO_005 1015 CDS 100% 13.200 10.560 N MFSD14A n/a
4 TRCN0000102120 CCTCAACACTTGAATACATAA pLKO.1 2205 3UTR 100% 13.200 9.240 N Mfsd14a n/a
5 TRCN0000308941 CCTCAACACTTGAATACATAA pLKO_005 2205 3UTR 100% 13.200 9.240 N Mfsd14a n/a
6 TRCN0000102124 CCTTGGCATTCTGTCCATTAT pLKO.1 1074 CDS 100% 13.200 9.240 N Mfsd14a n/a
7 TRCN0000308942 CCTTGGCATTCTGTCCATTAT pLKO_005 1074 CDS 100% 13.200 9.240 N Mfsd14a n/a
8 TRCN0000102121 CCCTAAACATACATTTCTGAT pLKO.1 408 CDS 100% 4.950 3.465 N Mfsd14a n/a
9 TRCN0000309005 CCCTAAACATACATTTCTGAT pLKO_005 408 CDS 100% 4.950 3.465 N Mfsd14a n/a
10 TRCN0000102123 GCTGATCTGTATCACGGTGTT pLKO.1 951 CDS 100% 4.050 2.835 N Mfsd14a n/a
11 TRCN0000309009 GCTGATCTGTATCACGGTGTT pLKO_005 951 CDS 100% 4.050 2.835 N Mfsd14a n/a
12 TRCN0000059676 GCCTTGTTTATTCCGGAACAT pLKO.1 1379 CDS 100% 4.950 3.465 N MFSD14A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.