Transcript: Mouse XM_006501191.2

PREDICTED: Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A (Sema4a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema4a (20351)
Length:
3271
CDS:
795..2570

Additional Resources:

NCBI RefSeq record:
XM_006501191.2
NBCI Gene record:
Sema4a (20351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067440 CGGACATTGAGCGAGTCTTTA pLKO.1 1318 CDS 100% 13.200 10.560 N Sema4a n/a
2 TRCN0000301597 CGGACATTGAGCGAGTCTTTA pLKO_005 1318 CDS 100% 13.200 10.560 N Sema4a n/a
3 TRCN0000067441 GCTTATCTCGTGGAGGAGATT pLKO.1 1647 CDS 100% 0.495 0.396 N Sema4a n/a
4 TRCN0000301595 GCTTATCTCGTGGAGGAGATT pLKO_005 1647 CDS 100% 0.495 0.396 N Sema4a n/a
5 TRCN0000421567 GACCTTCATGAAGGACCATTT pLKO_005 1454 CDS 100% 10.800 7.560 N SEMA4A n/a
6 TRCN0000067439 GCCTGTTCTCAAGACTGACAT pLKO.1 932 CDS 100% 4.950 3.465 N Sema4a n/a
7 TRCN0000301596 GCCTGTTCTCAAGACTGACAT pLKO_005 932 CDS 100% 4.950 3.465 N Sema4a n/a
8 TRCN0000058133 GCCAGCGAGTTTGACTTCTTT pLKO.1 1038 CDS 100% 5.625 3.375 N SEMA4A n/a
9 TRCN0000067438 CCTGGCCTTGAATATCCAGAA pLKO.1 522 5UTR 100% 4.050 2.430 N Sema4a n/a
10 TRCN0000301598 CCTGGCCTTGAATATCCAGAA pLKO_005 522 5UTR 100% 4.050 2.430 N Sema4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.