Transcript: Mouse XM_006501326.3

PREDICTED: Mus musculus RIKEN cDNA D930015E06 gene (D930015E06Rik), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem131l (229473)
Length:
4813
CDS:
70..4677

Additional Resources:

NCBI RefSeq record:
XM_006501326.3
NBCI Gene record:
Tmem131l (229473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379151 GAGTTTCCGAGGCCCTTTATT pLKO_005 1383 CDS 100% 15.000 21.000 N Tmem131l n/a
2 TRCN0000197736 GCATCGAAAGCTCTTTATTTA pLKO.1 563 CDS 100% 15.000 12.000 N Tmem131l n/a
3 TRCN0000366019 AGGAGGCTCTCTCCGATTTAA pLKO_005 2277 CDS 100% 15.000 10.500 N Tmem131l n/a
4 TRCN0000216211 CACATTGTGGCATGCATTATT pLKO.1 1577 CDS 100% 15.000 10.500 N Tmem131l n/a
5 TRCN0000216281 CAGATGAATCTGCAGTAAATA pLKO.1 959 CDS 100% 15.000 10.500 N Tmem131l n/a
6 TRCN0000366020 ACAGATATGCAGATGGTTAAT pLKO_005 1996 CDS 100% 13.200 9.240 N Tmem131l n/a
7 TRCN0000374428 CACAGGCAGAGACCACTAATA pLKO_005 725 CDS 100% 13.200 9.240 N Tmem131l n/a
8 TRCN0000216373 GATACAGGATATACATCATTT pLKO.1 1014 CDS 100% 13.200 9.240 N Tmem131l n/a
9 TRCN0000366018 GTTTACAGCTGCTAGACATTT pLKO_005 456 CDS 100% 13.200 9.240 N Tmem131l n/a
10 TRCN0000374429 TGGATTTGAAGTGCTAGATTG pLKO_005 2451 CDS 100% 10.800 7.560 N Tmem131l n/a
11 TRCN0000176482 CCAATGTATTTCTGACTACAA pLKO.1 1475 CDS 100% 4.950 3.465 N Tmem131l n/a
12 TRCN0000178458 GCACAGATATGCAGATGGTTA pLKO.1 1994 CDS 100% 4.950 3.465 N Tmem131l n/a
13 TRCN0000182059 CCGAACGCATACTTTCTGCTT pLKO.1 673 CDS 100% 2.640 1.848 N Tmem131l n/a
14 TRCN0000177255 GAAGAAGCATAAATGCTCCTT pLKO.1 2994 CDS 100% 2.640 1.848 N Tmem131l n/a
15 TRCN0000366097 CAACAGGAGTCTGGTCAATAT pLKO_005 1280 CDS 100% 13.200 7.920 N Tmem131l n/a
16 TRCN0000366095 GAGACATCAGCATCGTGTTTA pLKO_005 2504 CDS 100% 13.200 7.920 N Tmem131l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.