Transcript: Mouse XM_006501545.2

PREDICTED: Mus musculus ets variant 3 (Etv3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Etv3 (27049)
Length:
592
CDS:
97..573

Additional Resources:

NCBI RefSeq record:
XM_006501545.2
NBCI Gene record:
Etv3 (27049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501545.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231347 ACTACCCGTTCATCAACATTC pLKO_005 467 CDS 100% 10.800 15.120 N Etv3 n/a
2 TRCN0000235860 CAACAAGAGGATCCTTCATAA pLKO_005 390 CDS 100% 13.200 9.240 N Etv3 n/a
3 TRCN0000235863 GAGGTGGAGGGTATCAGTTTC pLKO_005 134 CDS 100% 10.800 7.560 N Etv3 n/a
4 TRCN0000231346 TTCCGGATTGGGCCTACAAAG pLKO_005 152 CDS 100% 10.800 7.560 N Etv3 n/a
5 TRCN0000417535 AGAAGGAGGTGGAGGGTATCA pLKO_005 129 CDS 100% 4.950 3.465 N ETV3 n/a
6 TRCN0000086569 CCCTCAGATACTATTACAACA pLKO.1 374 CDS 100% 4.950 3.465 N Etv3 n/a
7 TRCN0000013929 CCTCAGATACTATTACAACAA pLKO.1 375 CDS 100% 4.950 3.465 N ETV3 n/a
8 TRCN0000086571 CGGTTCCATTTCCCACCTCTA pLKO.1 552 CDS 100% 4.050 2.835 N Etv3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501545.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.