Transcript: Mouse XM_006501660.1

PREDICTED: Mus musculus far upstream element (FUSE) binding protein 1 (Fubp1), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fubp1 (51886)
Length:
3521
CDS:
126..2189

Additional Resources:

NCBI RefSeq record:
XM_006501660.1
NBCI Gene record:
Fubp1 (51886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294951 AGATGGGATGGTCGGATTTAT pLKO_005 500 CDS 100% 15.000 10.500 N Fubp1 n/a
2 TRCN0000294907 CAGGTGGTCAGCCGGATTATA pLKO_005 1999 CDS 100% 15.000 10.500 N Fubp1 n/a
3 TRCN0000096802 CCTACCAGAAAGGTCTTGTAT pLKO.1 602 CDS 100% 5.625 3.938 N Fubp1 n/a
4 TRCN0000096803 GCCTACCAGAAAGGTCTTGTA pLKO.1 601 CDS 100% 4.950 3.465 N Fubp1 n/a
5 TRCN0000287534 GCCTACCAGAAAGGTCTTGTA pLKO_005 601 CDS 100% 4.950 3.465 N Fubp1 n/a
6 TRCN0000096801 GCTGCTTATTATGCTCACTAT pLKO.1 1788 CDS 100% 4.950 3.465 N Fubp1 n/a
7 TRCN0000096800 GCAGAAATAATCACAGACCTT pLKO.1 1182 CDS 100% 2.640 1.848 N Fubp1 n/a
8 TRCN0000307467 TAGACAGCAAGCAGCGTATTA pLKO_005 2042 CDS 100% 13.200 7.920 N Fubp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.