Transcript: Mouse XM_006501763.3

PREDICTED: Mus musculus deoxyribonuclease II beta (Dnase2b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnase2b (56629)
Length:
2969
CDS:
1004..2068

Additional Resources:

NCBI RefSeq record:
XM_006501763.3
NBCI Gene record:
Dnase2b (56629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202712 CCTAGTATAATAGAGGTCTAT pLKO.1 2872 3UTR 100% 4.950 6.930 N Dnase2b n/a
2 TRCN0000203578 GCCTAGTATAATAGAGGTCTA pLKO.1 2871 3UTR 100% 4.050 3.240 N Dnase2b n/a
3 TRCN0000186017 CATCTGTATGACACACATAAT pLKO.1 1268 CDS 100% 13.200 9.240 N Dnase2b n/a
4 TRCN0000203095 GCTGGTTTATAGTTTAGTCTT pLKO.1 2483 3UTR 100% 4.950 3.465 N Dnase2b n/a
5 TRCN0000204773 GCATCTGCATCACTTTCGGAT pLKO.1 1488 CDS 100% 2.640 1.848 N Dnase2b n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 768 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.