Transcript: Mouse XM_006502342.3

PREDICTED: Mus musculus immunoglobulin superfamily, member 3 (Igsf3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Igsf3 (78908)
Length:
7400
CDS:
734..4378

Additional Resources:

NCBI RefSeq record:
XM_006502342.3
NBCI Gene record:
Igsf3 (78908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105699 GCCTTCAACAGCTCACTCATT pLKO.1 1688 CDS 100% 4.950 6.930 N Igsf3 n/a
2 TRCN0000105697 CCGTGCGTCTGGAAACAGATA pLKO.1 1578 CDS 100% 4.950 3.960 N Igsf3 n/a
3 TRCN0000105698 GAGTTACAGTGCCAAGATGAA pLKO.1 1126 CDS 100% 4.950 3.465 N Igsf3 n/a
4 TRCN0000105695 GCCTTCATAGTAACAAGGATT pLKO.1 4828 3UTR 100% 4.950 3.465 N Igsf3 n/a
5 TRCN0000105696 GTGGCGAAGGAATTACAACAA pLKO.1 2740 CDS 100% 4.950 3.465 N Igsf3 n/a
6 TRCN0000147122 CACAGATAACTGGGTAGTTAA pLKO.1 1954 CDS 100% 1.320 0.924 N IGSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.