Transcript: Mouse XM_006502615.1

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily j, polypeptide 11 (Cyp2j11), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2j11 (100066)
Length:
1609
CDS:
108..1307

Additional Resources:

NCBI RefSeq record:
XM_006502615.1
NBCI Gene record:
Cyp2j11 (100066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126466 CCAGTTGTGAACTGTTCATTT pLKO.1 1159 CDS 100% 13.200 9.240 N Cyp2j11 n/a
2 TRCN0000126465 GCACTGACAATACTCAAGAAT pLKO.1 219 CDS 100% 5.625 3.938 N Cyp2j11 n/a
3 TRCN0000126467 GTTCTGATCAATTTGACTGAT pLKO.1 999 CDS 100% 4.950 3.465 N Cyp2j11 n/a
4 TRCN0000126464 GCATAACAGAATGAAGGAGAT pLKO.1 1394 3UTR 100% 4.050 2.835 N Cyp2j11 n/a
5 TRCN0000126472 CCCTACACCAATGCTGTCATT pLKO.1 876 CDS 100% 4.950 2.475 Y Cyp2d9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.