Transcript: Mouse XM_006502714.2

PREDICTED: Mus musculus colony stimulating factor 3 receptor (granulocyte) (Csf3r), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csf3r (12986)
Length:
3318
CDS:
206..2719

Additional Resources:

NCBI RefSeq record:
XM_006502714.2
NBCI Gene record:
Csf3r (12986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067128 GCTGTGGACACATCGAGATTT pLKO.1 279 CDS 100% 13.200 9.240 N Csf3r n/a
2 TRCN0000089036 CCCAGGAGTAATGCAGTACAT pLKO.1 2491 CDS 100% 4.950 3.465 N EG433259 n/a
3 TRCN0000067130 CCCAGTCTACACCCTACAGAT pLKO.1 1108 CDS 100% 4.950 3.465 N Csf3r n/a
4 TRCN0000067131 GACTGGAGTTACCCTGATCTT pLKO.1 232 CDS 100% 4.950 3.465 N Csf3r n/a
5 TRCN0000067129 GCAAACGCAGAGGAAAGACTT pLKO.1 2154 CDS 100% 4.950 3.465 N Csf3r n/a
6 TRCN0000067132 GCTGAGCTTCACGCAGGCTAT pLKO.1 551 CDS 100% 1.350 0.945 N Csf3r n/a
7 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 3214 3UTR 100% 4.950 2.475 Y Gad2 n/a
8 TRCN0000089033 CCCAATGGTCACCATTCGTAT pLKO.1 2930 3UTR 100% 4.950 3.465 N EG433259 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.