Transcript: Mouse XM_006502907.3

PREDICTED: Mus musculus Scl/Tal1 interrupting locus (Stil), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stil (20460)
Length:
2638
CDS:
315..2525

Additional Resources:

NCBI RefSeq record:
XM_006502907.3
NBCI Gene record:
Stil (20460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198100 CGTCATGCTAAGCAGAATAAA pLKO.1 480 CDS 100% 15.000 12.000 N Stil n/a
2 TRCN0000182867 CCCGACCTTCAGTTTCAGTTA pLKO.1 1251 CDS 100% 4.950 3.960 N Stil n/a
3 TRCN0000328002 CCCGACCTTCAGTTTCAGTTA pLKO_005 1251 CDS 100% 4.950 3.960 N Stil n/a
4 TRCN0000328075 CAAGTTCAGGGAACCTATAAA pLKO_005 957 CDS 100% 15.000 10.500 N Stil n/a
5 TRCN0000328076 TTTGATCCTGGTCGAGAAATA pLKO_005 579 CDS 100% 13.200 9.240 N Stil n/a
6 TRCN0000181491 GCAGTCATCTACCTGTAAGAA pLKO.1 1781 CDS 100% 5.625 3.938 N Stil n/a
7 TRCN0000328073 GCAGTCATCTACCTGTAAGAA pLKO_005 1781 CDS 100% 5.625 3.938 N Stil n/a
8 TRCN0000181769 GCTGAGAAACTTCAAGCAGTT pLKO.1 1866 CDS 100% 4.050 2.835 N Stil n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.