Transcript: Mouse XM_006502947.4

PREDICTED: Mus musculus cytochrome b5 reductase-like (Cyb5rl), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cyb5rl (230582)
Length:
2864
CDS:
100..1368

Additional Resources:

NCBI RefSeq record:
XM_006502947.4
NBCI Gene record:
Cyb5rl (230582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502947.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099064 CCGGAGAAAGCCGTTTACCTT pLKO.1 1260 CDS 100% 3.000 2.400 N Cyb5rl n/a
2 TRCN0000332073 CCGGAGAAAGCCGTTTACCTT pLKO_005 1260 CDS 100% 3.000 2.400 N Cyb5rl n/a
3 TRCN0000099061 GCAGAAGGATACTTTGACGTT pLKO.1 700 CDS 100% 2.640 2.112 N Cyb5rl n/a
4 TRCN0000332071 GCAGAAGGATACTTTGACGTT pLKO_005 700 CDS 100% 2.640 2.112 N Cyb5rl n/a
5 TRCN0000099063 CTACCGTGACAAGACCCATTT pLKO.1 1194 CDS 100% 10.800 7.560 N Cyb5rl n/a
6 TRCN0000353718 CTACCGTGACAAGACCCATTT pLKO_005 1194 CDS 100% 10.800 7.560 N Cyb5rl n/a
7 TRCN0000099062 GACACCTATCTTGTCCGGTTT pLKO.1 565 CDS 100% 4.050 2.835 N Cyb5rl n/a
8 TRCN0000332072 GACACCTATCTTGTCCGGTTT pLKO_005 565 CDS 100% 4.050 2.835 N Cyb5rl n/a
9 TRCN0000099060 GCAAATGTCATCACCATGGAA pLKO.1 1475 3UTR 100% 3.000 2.100 N Cyb5rl n/a
10 TRCN0000332074 GCAAATGTCATCACCATGGAA pLKO_005 1475 3UTR 100% 3.000 2.100 N Cyb5rl n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2477 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502947.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.