Transcript: Mouse XM_006503111.4

PREDICTED: Mus musculus MAP7 domain containing 1 (Map7d1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Map7d1 (245877)
Length:
3495
CDS:
471..2906

Additional Resources:

NCBI RefSeq record:
XM_006503111.4
NBCI Gene record:
Map7d1 (245877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503111.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323345 CAAACACGTGGACTCTATAAT pLKO_005 1244 CDS 100% 15.000 21.000 N MAP7D1 n/a
2 TRCN0000091389 CGTGGACTCTATAATCAACAA pLKO.1 1250 CDS 100% 4.950 6.930 N Map7d1 n/a
3 TRCN0000091391 GCATTGTGGATCGTCTGATGA pLKO.1 1351 CDS 100% 4.950 6.930 N Map7d1 n/a
4 TRCN0000091388 GCCACACAATACTGGTTGCTT pLKO.1 3384 3UTR 100% 3.000 4.200 N Map7d1 n/a
5 TRCN0000108291 GCAGAAGCCTTCCTCAAGAAA pLKO.1 2847 CDS 100% 5.625 3.938 N MAP7D1 n/a
6 TRCN0000091392 CCTCCTGCCAAGCAAGATGTA pLKO.1 852 CDS 100% 4.950 3.465 N Map7d1 n/a
7 TRCN0000091390 CCACAGGTCACAGAAGTTCTT pLKO.1 2883 CDS 100% 4.950 2.970 N Map7d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503111.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.