Transcript: Mouse XM_006503112.4

PREDICTED: Mus musculus MAP7 domain containing 1 (Map7d1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Map7d1 (245877)
Length:
3449
CDS:
431..2860

Additional Resources:

NCBI RefSeq record:
XM_006503112.4
NBCI Gene record:
Map7d1 (245877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503112.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091391 GCATTGTGGATCGTCTGATGA pLKO.1 1209 CDS 100% 4.950 6.930 N Map7d1 n/a
2 TRCN0000091388 GCCACACAATACTGGTTGCTT pLKO.1 3338 3UTR 100% 3.000 4.200 N Map7d1 n/a
3 TRCN0000108291 GCAGAAGCCTTCCTCAAGAAA pLKO.1 2801 CDS 100% 5.625 3.938 N MAP7D1 n/a
4 TRCN0000091392 CCTCCTGCCAAGCAAGATGTA pLKO.1 812 CDS 100% 4.950 3.465 N Map7d1 n/a
5 TRCN0000091390 CCACAGGTCACAGAAGTTCTT pLKO.1 2837 CDS 100% 4.950 2.970 N Map7d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503112.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.