Transcript: Mouse XM_006503133.2

PREDICTED: Mus musculus zinc finger and SCAN domains 20 (Zscan20), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zscan20 (269585)
Length:
10234
CDS:
208..3300

Additional Resources:

NCBI RefSeq record:
XM_006503133.2
NBCI Gene record:
Zscan20 (269585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084642 CTGGCGCCTTATCAAGATATA pLKO.1 2123 CDS 100% 13.200 18.480 N Zscan20 n/a
2 TRCN0000430132 TGAGGCAGATGGGTGATATTG pLKO_005 3568 3UTR 100% 13.200 18.480 N Zscan20 n/a
3 TRCN0000084638 CCGGGTAATTTGGAAGTGAAT pLKO.1 3433 3UTR 100% 4.950 6.930 N Zscan20 n/a
4 TRCN0000415744 GTGCTCACTGGAGACGAAATT pLKO_005 2681 CDS 100% 13.200 9.240 N Zscan20 n/a
5 TRCN0000414327 GAGGACCATGTGAACGGAAAT pLKO_005 2179 CDS 100% 10.800 7.560 N Zscan20 n/a
6 TRCN0000084639 CGGACCCATTCAAGTGAGAAA pLKO.1 2356 CDS 100% 4.950 3.465 N Zscan20 n/a
7 TRCN0000084641 CTCATCATTCACCAGCGGATT pLKO.1 3172 CDS 100% 4.050 2.835 N Zscan20 n/a
8 TRCN0000084640 CGCTACCGATTCAAGAACCTT pLKO.1 1795 CDS 100% 3.000 2.100 N Zscan20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.