Transcript: Mouse XM_006503162.1

PREDICTED: Mus musculus asparagine-linked glycosylation 6 (alpha-1,3,-glucosyltransferase) (Alg6), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Alg6 (320438)
Length:
2630
CDS:
230..1240

Additional Resources:

NCBI RefSeq record:
XM_006503162.1
NBCI Gene record:
Alg6 (320438)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248089 AGGATAAAGTCGCTAATATTT pLKO_005 531 CDS 100% 15.000 21.000 N Alg6 n/a
2 TRCN0000248088 CCCTTAATTTACCAGTCAAAC pLKO_005 372 CDS 100% 10.800 15.120 N Alg6 n/a
3 TRCN0000248092 ACCTTGTTAACACCGAAATAA pLKO_005 2455 3UTR 100% 15.000 12.000 N Alg6 n/a
4 TRCN0000248090 CACCTATGTTTGGTGATTATG pLKO_005 324 CDS 100% 13.200 9.240 N Alg6 n/a
5 TRCN0000428953 GTTAGCTGTGCGCTATCATTC pLKO_005 704 CDS 100% 10.800 7.560 N ALG6 n/a
6 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 2060 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.