Transcript: Mouse XM_006503179.3

PREDICTED: Mus musculus ubiquitin specific peptidase 24 (Usp24), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp24 (329908)
Length:
5953
CDS:
247..5868

Additional Resources:

NCBI RefSeq record:
XM_006503179.3
NBCI Gene record:
Usp24 (329908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417040 ACAATACTGTGATCGAATAAA pLKO_005 1596 CDS 100% 15.000 21.000 N Usp24 n/a
2 TRCN0000423321 GATTTGCGGTGCCAGTTATTA pLKO_005 4834 CDS 100% 15.000 21.000 N Usp24 n/a
3 TRCN0000422803 TAATCTAAACCCTAGGTTAAA pLKO_005 2853 CDS 100% 13.200 18.480 N Usp24 n/a
4 TRCN0000086745 TCATTGGTCTATCCCGTACAA pLKO.1 651 CDS 100% 4.950 6.930 N Usp24 n/a
5 TRCN0000435564 GGAAGTAGCCAGCCAATTAAA pLKO_005 4345 CDS 100% 15.000 12.000 N Usp24 n/a
6 TRCN0000040632 GCTTGGTTCATCACTGATTAA pLKO.1 5055 CDS 100% 13.200 10.560 N Usp24 n/a
7 TRCN0000086747 CCAATTTGTATGAGCTGGAAA pLKO.1 614 CDS 100% 4.950 3.465 N Usp24 n/a
8 TRCN0000040628 GCTGGATTCTTTAGGCAGAAA pLKO.1 3657 CDS 100% 4.950 3.465 N Usp24 n/a
9 TRCN0000086746 CCCGAGCTCTTGTCTGCCATT pLKO.1 1321 CDS 100% 1.350 0.945 N Usp24 n/a
10 TRCN0000040630 CCTCATTTCATGGACATCTTT pLKO.1 3155 CDS 100% 5.625 3.375 N Usp24 n/a
11 TRCN0000086744 CCTGATAATGAATACCACTTT pLKO.1 949 CDS 100% 4.950 2.970 N Usp24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.