Transcript: Mouse XM_006503371.2

PREDICTED: Mus musculus cilia and flagella associated protein 57 (Cfap57), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cfap57 (68625)
Length:
3779
CDS:
97..3633

Additional Resources:

NCBI RefSeq record:
XM_006503371.2
NBCI Gene record:
Cfap57 (68625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201949 CGTCGACTCAGATGTGGATTT pLKO.1 3594 CDS 100% 10.800 15.120 N Cfap57 n/a
2 TRCN0000202123 CGCTCCCAAATCTATGACCTT pLKO.1 3343 CDS 100% 2.640 3.696 N Cfap57 n/a
3 TRCN0000201982 CGAGATGCAACGTCTGGAAAT pLKO.1 3492 CDS 100% 10.800 8.640 N Cfap57 n/a
4 TRCN0000189618 CTTGAATCGGCCCTGAAAGTA pLKO.1 3361 CDS 100% 5.625 3.938 N Cfap57 n/a
5 TRCN0000201135 CCCTGAAAGTATCCAAGAAGA pLKO.1 3371 CDS 100% 4.950 3.465 N Cfap57 n/a
6 TRCN0000189439 CCAGAGTCAGTGATAAGCAAG pLKO.1 3409 CDS 100% 4.050 2.835 N Cfap57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.