Transcript: Mouse XM_006503378.2

PREDICTED: Mus musculus small ArfGAP 2 (Smap2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smap2 (69780)
Length:
1154
CDS:
83..1129

Additional Resources:

NCBI RefSeq record:
XM_006503378.2
NBCI Gene record:
Smap2 (69780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503378.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295673 TGAAGGATTTATTCGAGATAA pLKO_005 172 CDS 100% 13.200 18.480 N Smap2 n/a
2 TRCN0000106198 CGACTCTATGAAGCCTACCTT pLKO.1 113 CDS 100% 3.000 2.400 N Smap2 n/a
3 TRCN0000295674 AGTCCTCAGATGTGGAAATAA pLKO_005 1109 CDS 100% 15.000 10.500 N Smap2 n/a
4 TRCN0000437478 TGGATCCCAGACGCCTCAAAT pLKO_005 655 CDS 100% 13.200 9.240 N SMAP2 n/a
5 TRCN0000295676 ACCGAAGTCTGGACATCAATG pLKO_005 216 CDS 100% 10.800 7.560 N Smap2 n/a
6 TRCN0000413395 ACCGAAGTCTGGACATCAATG pLKO_005 216 CDS 100% 10.800 7.560 N SMAP2 n/a
7 TRCN0000106196 GCAAACAGTAAGACCAGCAAT pLKO.1 437 CDS 100% 4.950 3.465 N Smap2 n/a
8 TRCN0000288412 GCAAACAGTAAGACCAGCAAT pLKO_005 437 CDS 100% 4.950 3.465 N Smap2 n/a
9 TRCN0000106197 CCATCCTATCACTGTATGGAT pLKO.1 639 CDS 100% 3.000 2.100 N Smap2 n/a
10 TRCN0000106199 GCCTACCTTCCCGAGACCTTT pLKO.1 125 CDS 100% 1.650 1.155 N Smap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503378.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.