Transcript: Mouse XM_006503551.3

PREDICTED: Mus musculus ATP-binding cassette, sub-family B (MDR/TAP), member 4 (Abcb4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcb4 (18670)
Length:
3972
CDS:
289..3921

Additional Resources:

NCBI RefSeq record:
XM_006503551.3
NBCI Gene record:
Abcb4 (18670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111089 GCTGGAAAGCACGCATATTTA pLKO.1 2255 CDS 100% 15.000 21.000 N Abcb4 n/a
2 TRCN0000111086 GCATACTTGTTCAGCCTGTTT pLKO.1 3292 CDS 100% 4.950 3.960 N Abcb4 n/a
3 TRCN0000111085 CGACAAGAAATGGGCTGGTTT pLKO.1 754 CDS 100% 4.950 3.465 N Abcb4 n/a
4 TRCN0000111087 GCCTATGTGATCTTTGACATT pLKO.1 1369 CDS 100% 4.950 3.465 N Abcb4 n/a
5 TRCN0000111088 CCACATCAGAATAGGCTGGAT pLKO.1 2305 CDS 100% 2.640 1.848 N Abcb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.