Transcript: Mouse XM_006503565.3

PREDICTED: Mus musculus cilia and flagella associated protein 69 (Cfap69), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cfap69 (207686)
Length:
6309
CDS:
2715..4391

Additional Resources:

NCBI RefSeq record:
XM_006503565.3
NBCI Gene record:
Cfap69 (207686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175738 GTTCCACAGCTCCTGAAATAA pLKO.1 4395 3UTR 100% 15.000 12.000 N Cfap69 n/a
2 TRCN0000174442 CCAGTCTGACACATTACTTAT pLKO.1 3164 CDS 100% 13.200 9.240 N Cfap69 n/a
3 TRCN0000193185 CGGCAAGATTGTTGATACAAA pLKO.1 3602 CDS 100% 5.625 3.938 N Cfap69 n/a
4 TRCN0000174817 GCACAGTATGAAGAACTACAA pLKO.1 2805 CDS 100% 4.950 3.465 N Cfap69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.