Transcript: Mouse XM_006503661.3

PREDICTED: Mus musculus Wolf-Hirschhorn syndrome candidate 1 (human) (Whsc1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nsd2 (107823)
Length:
8015
CDS:
248..2194

Additional Resources:

NCBI RefSeq record:
XM_006503661.3
NBCI Gene record:
Nsd2 (107823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503661.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218710 CCAGAAAGAGCTTGGATATTT pLKO_005 1058 CDS 100% 15.000 12.000 N Nsd2 n/a
2 TRCN0000253039 CCCACTCCTTCACAATCATAC pLKO_005 976 CDS 100% 10.800 8.640 N Nsd2 n/a
3 TRCN0000019818 CCCAGAAAGAGCTTGGATATT pLKO.1 1057 CDS 100% 13.200 9.240 N NSD2 n/a
4 TRCN0000274183 CCCAGAAAGAGCTTGGATATT pLKO_005 1057 CDS 100% 13.200 9.240 N NSD2 n/a
5 TRCN0000226295 CCTGGTGCTCATGATACTAAA pLKO_005 518 CDS 100% 13.200 9.240 N Nsd2 n/a
6 TRCN0000253040 CTGTGAGAGAAGAGGATATTC pLKO_005 1413 CDS 100% 13.200 9.240 N Nsd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503661.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.