Transcript: Mouse XM_006503752.2

PREDICTED: Mus musculus LIM domain binding 2 (Ldb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ldb2 (16826)
Length:
2537
CDS:
268..1386

Additional Resources:

NCBI RefSeq record:
XM_006503752.2
NBCI Gene record:
Ldb2 (16826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271811 CTTGCCATGGGTCCGAATATT pLKO_005 2147 3UTR 100% 15.000 21.000 N Ldb2 n/a
2 TRCN0000284533 GACCTGTACTACATCCTTAAA pLKO_005 562 CDS 100% 13.200 18.480 N Ldb2 n/a
3 TRCN0000021805 CGAAAGGCTAATCACTAGATT pLKO.1 1212 CDS 100% 5.625 7.875 N LDB2 n/a
4 TRCN0000021806 CCGAATCTATGAGATGAACAA pLKO.1 357 CDS 100% 4.950 6.930 N LDB2 n/a
5 TRCN0000095705 CGGACCAAAGCGATACACTAT pLKO.1 486 CDS 100% 4.950 6.930 N Ldb2 n/a
6 TRCN0000095706 GAAAGGCTAATCACTAGATTA pLKO.1 1213 CDS 100% 1.320 1.848 N Ldb2 n/a
7 TRCN0000271857 TGATGACCTCATGAGAATAAA pLKO_005 714 CDS 100% 15.000 10.500 N Ldb2 n/a
8 TRCN0000095708 GCCACATTAACACTTTCATTT pLKO.1 454 CDS 100% 13.200 9.240 N Ldb2 n/a
9 TRCN0000271810 AGCCAGAGTACCGAATCTATG pLKO_005 347 CDS 100% 10.800 7.560 N Ldb2 n/a
10 TRCN0000271809 CCACAAGCAGCACGTCCAATA pLKO_005 1052 CDS 100% 10.800 7.560 N Ldb2 n/a
11 TRCN0000095704 CCATTCGCAAATCTCTACTAT pLKO.1 1439 3UTR 100% 5.625 3.938 N Ldb2 n/a
12 TRCN0000095707 GCACTTTACCATTAGACAGTA pLKO.1 741 CDS 100% 4.950 3.465 N Ldb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.