Transcript: Mouse XM_006503815.3

PREDICTED: Mus musculus slit homolog 2 (Drosophila) (Slit2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slit2 (20563)
Length:
9046
CDS:
1938..6539

Additional Resources:

NCBI RefSeq record:
XM_006503815.3
NBCI Gene record:
Slit2 (20563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328178 CTTGACCATGTTGGACTAATT pLKO_005 6584 3UTR 100% 13.200 18.480 N Slit2 n/a
2 TRCN0000328114 GAACGGATAAGGGACTATTAC pLKO_005 6315 CDS 100% 13.200 18.480 N Slit2 n/a
3 TRCN0000120818 GCCCAGTGTATCATCAGGATA pLKO.1 5349 CDS 100% 4.950 6.930 N Slit2 n/a
4 TRCN0000120817 GCTACCAGTTTCCAGTATTAA pLKO.1 7156 3UTR 100% 15.000 10.500 N Slit2 n/a
5 TRCN0000328094 GCTGGAAAGACTGCGTTTAAA pLKO_005 2249 CDS 100% 15.000 10.500 N Slit2 n/a
6 TRCN0000120820 GCCTGTCAAACAACTAAGAAA pLKO.1 6357 CDS 100% 5.625 3.938 N Slit2 n/a
7 TRCN0000328112 GCCTGTCAAACAACTAAGAAA pLKO_005 6357 CDS 100% 5.625 3.938 N Slit2 n/a
8 TRCN0000120821 GCCTTGTCACACTTAGCGATT pLKO.1 4497 CDS 100% 4.050 2.835 N Slit2 n/a
9 TRCN0000328111 GCCTTGTCACACTTAGCGATT pLKO_005 4497 CDS 100% 4.050 2.835 N Slit2 n/a
10 TRCN0000120819 GCCAACAAGATAAACTGCCTT pLKO.1 3090 CDS 100% 2.640 1.848 N Slit2 n/a
11 TRCN0000056308 CCTGGAGAAATGGCAGATAAA pLKO.1 4614 CDS 100% 13.200 7.920 N SLIT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.