Transcript: Mouse XM_006503851.2

PREDICTED: Mus musculus toll-like receptor 1 (Tlr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tlr1 (21897)
Length:
3005
CDS:
455..2842

Additional Resources:

NCBI RefSeq record:
XM_006503851.2
NBCI Gene record:
Tlr1 (21897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378525 CCGTCCCAAGTTAGCCCATTT pLKO_005 1493 CDS 100% 10.800 15.120 N Tlr1 n/a
2 TRCN0000065629 GCCTTCAGGATGTTCAATTAT pLKO.1 1325 CDS 100% 15.000 12.000 N Tlr1 n/a
3 TRCN0000362884 CAACAGACTCCAGTATCTTAA pLKO_005 697 CDS 100% 13.200 9.240 N Tlr1 n/a
4 TRCN0000362886 CCCTTGCAAACAACTACTTTA pLKO_005 593 CDS 100% 13.200 9.240 N Tlr1 n/a
5 TRCN0000362887 GTACTCCATCCCTACCAATTA pLKO_005 2671 CDS 100% 13.200 9.240 N Tlr1 n/a
6 TRCN0000065630 GCTCTCAAATCTTACCCTGAA pLKO.1 1198 CDS 100% 4.050 2.835 N Tlr1 n/a
7 TRCN0000065631 GCTTATCATAAAGAGGCCAAA pLKO.1 541 CDS 100% 4.050 2.835 N Tlr1 n/a
8 TRCN0000065632 CCCTACCAATTACCACAAGCT pLKO.1 2680 CDS 100% 2.640 1.848 N Tlr1 n/a
9 TRCN0000065628 CCTGCCTATATGCAAAGAATT pLKO.1 847 CDS 100% 0.000 0.000 N Tlr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.