Transcript: Mouse XM_006503974.2

PREDICTED: Mus musculus cytokine-dependent hematopoietic cell linker (Clnk), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clnk (27278)
Length:
2463
CDS:
143..1450

Additional Resources:

NCBI RefSeq record:
XM_006503974.2
NBCI Gene record:
Clnk (27278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249679 ATACGCAGATACACGCTATTT pLKO_005 427 CDS 100% 13.200 18.480 N Clnk n/a
2 TRCN0000192964 GCCAACGCTTTAAAGGATTCA pLKO.1 576 CDS 100% 4.950 6.930 N Clnk n/a
3 TRCN0000249678 CATTGAACACTACACATATTT pLKO_005 1306 CDS 100% 15.000 10.500 N Clnk n/a
4 TRCN0000249676 TGAATGGTACATTGGAGAATA pLKO_005 1063 CDS 100% 13.200 9.240 N Clnk n/a
5 TRCN0000249680 TGTCAGAAGCCAACGCTTTAA pLKO_005 568 CDS 100% 13.200 9.240 N Clnk n/a
6 TRCN0000249677 GGCACAGGACTACGAGGAAAT pLKO_005 1259 CDS 100% 10.800 7.560 N Clnk n/a
7 TRCN0000190387 CGACTACGAAGATCCTGAGTT pLKO.1 343 CDS 100% 4.950 3.465 N Clnk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.