Transcript: Mouse XM_006504006.4

PREDICTED: Mus musculus NEDD4 binding protein 2 (N4bp2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
N4bp2 (333789)
Length:
8471
CDS:
326..5602

Additional Resources:

NCBI RefSeq record:
XM_006504006.4
NBCI Gene record:
N4bp2 (333789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504006.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257183 GGAGCTTGCGAGACGTAATAT pLKO_005 1987 CDS 100% 15.000 21.000 N N4bp2 n/a
2 TRCN0000242226 ATAACCCAGGTGGCGTCATTC pLKO_005 1722 CDS 100% 10.800 8.640 N N4bp2 n/a
3 TRCN0000216229 CTCCAGTAATCATAGATAATA pLKO.1 1860 CDS 100% 15.000 10.500 N N4bp2 n/a
4 TRCN0000216052 CTGATGACTACTTCTATATAA pLKO.1 1749 CDS 100% 15.000 10.500 N N4bp2 n/a
5 TRCN0000257163 TAACGACCCTTCCACCTTTAT pLKO_005 847 CDS 100% 13.200 9.240 N N4bp2 n/a
6 TRCN0000242224 TGTTAGAGGTTGTGGCAATTT pLKO_005 1084 CDS 100% 13.200 9.240 N N4bp2 n/a
7 TRCN0000242225 TAAACGGACAGTACCAGTTTG pLKO_005 1767 CDS 100% 10.800 7.560 N N4bp2 n/a
8 TRCN0000192027 CCACCTTTATGAACTCAGATT pLKO.1 858 CDS 100% 4.950 3.465 N N4bp2 n/a
9 TRCN0000189823 GCAGTGTTATCTGTGCGTGAT pLKO.1 2255 CDS 100% 4.050 2.835 N N4bp2 n/a
10 TRCN0000200983 CCCACAAAGTATTAGATGCTA pLKO.1 2793 CDS 100% 3.000 2.100 N N4bp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504006.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.