Transcript: Mouse XM_006504029.3

PREDICTED: Mus musculus protocadherin 7 (Pcdh7), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcdh7 (54216)
Length:
9005
CDS:
1510..4767

Additional Resources:

NCBI RefSeq record:
XM_006504029.3
NBCI Gene record:
Pcdh7 (54216)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340338 ACGTTCCCTCCATCGAAATTC pLKO_005 2741 CDS 100% 13.200 18.480 N Pcdh7 n/a
2 TRCN0000340336 ACTTCGAGGTGTCGGTGATAG pLKO_005 1841 CDS 100% 10.800 15.120 N Pcdh7 n/a
3 TRCN0000094231 CCAGTTGAGATTCACAGTAAT pLKO.1 2646 CDS 100% 13.200 10.560 N Pcdh7 n/a
4 TRCN0000340413 ACGACAACGACCCTAAGTTTA pLKO_005 3407 CDS 100% 13.200 9.240 N Pcdh7 n/a
5 TRCN0000094233 CAGCAGCATGACAAATCTAAA pLKO.1 4285 CDS 100% 13.200 9.240 N Pcdh7 n/a
6 TRCN0000055744 GCAGGAGACAACATTTCAATT pLKO.1 4606 CDS 100% 13.200 9.240 N PCDH7 n/a
7 TRCN0000291662 GCAGGAGACAACATTTCAATT pLKO_005 4606 CDS 100% 13.200 9.240 N PCDH7 n/a
8 TRCN0000340414 TCAATGGACAGATCGAGTATG pLKO_005 2525 CDS 100% 10.800 7.560 N Pcdh7 n/a
9 TRCN0000055746 CCAAGCTATGAAATTAGCAAA pLKO.1 4114 CDS 100% 4.950 3.465 N PCDH7 n/a
10 TRCN0000291727 CCAAGCTATGAAATTAGCAAA pLKO_005 4114 CDS 100% 4.950 3.465 N PCDH7 n/a
11 TRCN0000094232 GCGGACTTGAACTACAGCATT pLKO.1 3838 CDS 100% 4.950 3.465 N Pcdh7 n/a
12 TRCN0000094230 GCTGGCATTATGACAGTGATT pLKO.1 4165 CDS 100% 4.950 3.465 N Pcdh7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.