Transcript: Mouse XM_006504204.3

PREDICTED: Mus musculus klotho beta (Klb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klb (83379)
Length:
2815
CDS:
90..2492

Additional Resources:

NCBI RefSeq record:
XM_006504204.3
NBCI Gene record:
Klb (83379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504204.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193105 CGACTATCCATCGGTTATGAA pLKO.1 1694 CDS 100% 5.625 7.875 N Klb n/a
2 TRCN0000215752 GACAAGTGTTAAGGTACTATA pLKO.1 1204 CDS 100% 13.200 10.560 N Klb n/a
3 TRCN0000175979 GCTCCATGTACTGGTAACTTA pLKO.1 2529 3UTR 100% 5.625 4.500 N Klb n/a
4 TRCN0000175536 CCTCTGAAGTGTGGTTCAAAT pLKO.1 2592 3UTR 100% 13.200 9.240 N Klb n/a
5 TRCN0000194627 GCACCTCTATGATAGGCAGTA pLKO.1 1523 CDS 100% 4.050 2.835 N Klb n/a
6 TRCN0000173908 GAAGGAATACATCGCCTCCAA pLKO.1 1712 CDS 100% 2.640 1.848 N Klb n/a
7 TRCN0000174603 GAGAAATCTAAGCCTAGATTT pLKO.1 2160 CDS 100% 1.320 0.924 N Klb n/a
8 TRCN0000330030 CCAAGGCCTTCCAGGACTATA pLKO_005 1354 CDS 100% 13.200 9.240 N SSBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504204.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.