Transcript: Mouse XM_006504206.3

PREDICTED: Mus musculus otoferlin (Otof), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Otof (83762)
Length:
7690
CDS:
906..6899

Additional Resources:

NCBI RefSeq record:
XM_006504206.3
NBCI Gene record:
Otof (83762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104953 CGCAATGAGAATGATGAGTTT pLKO.1 6588 CDS 100% 4.950 6.930 N Otof n/a
2 TRCN0000104952 CCTCCCTGATTCACAATTATA pLKO.1 4408 CDS 100% 15.000 12.000 N Otof n/a
3 TRCN0000424854 GCGCAAGCCCTGCATCTATAT pLKO_005 3023 CDS 100% 13.200 10.560 N Otof n/a
4 TRCN0000429564 ACGGTGAAGCTCACGAGTTAC pLKO_005 3958 CDS 100% 10.800 8.640 N Otof n/a
5 TRCN0000104950 CCAGTGAAATTAACCAAGAAA pLKO.1 7227 3UTR 100% 5.625 3.938 N Otof n/a
6 TRCN0000104951 GCCTCAATGATTGACCGGAAA pLKO.1 2757 CDS 100% 4.050 2.430 N Otof n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 643 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.