Transcript: Mouse XM_006504360.3

PREDICTED: Mus musculus elastin (Eln), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eln (13717)
Length:
3801
CDS:
324..2858

Additional Resources:

NCBI RefSeq record:
XM_006504360.3
NBCI Gene record:
Eln (13717)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414557 CCGCCAAAGCTGCTAAGTATG pLKO_005 1711 CDS 100% 10.800 15.120 N Eln n/a
2 TRCN0000437263 CAACGTTGGTGCTACTGCTTG pLKO_005 2890 3UTR 100% 4.050 5.670 N ELN n/a
3 TRCN0000091975 GCTGCATCCAAAGCTGCTAAA pLKO.1 2268 CDS 100% 10.800 8.640 N Eln n/a
4 TRCN0000091973 GCTCCCTTGTTCTTATGGAAT pLKO.1 3458 3UTR 100% 4.950 3.960 N Eln n/a
5 TRCN0000446384 GTTCCCGGTGGAGTCTATTAT pLKO_005 399 CDS 100% 15.000 10.500 N Eln n/a
6 TRCN0000091974 CCACTGGGTTATCCCATCAAA pLKO.1 1071 CDS 100% 5.625 3.938 N Eln n/a
7 TRCN0000091976 GCAGCTAAAGCAGCCAAGTAT pLKO.1 1221 CDS 100% 5.625 3.938 N Eln n/a
8 TRCN0000091977 GCTTATAAAGCTGCCGCCAAA pLKO.1 636 CDS 100% 4.050 2.835 N Eln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.