Transcript: Mouse XM_006504399.1

PREDICTED: Mus musculus P450 (cytochrome) oxidoreductase (Por), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Por (18984)
Length:
2496
CDS:
91..2127

Additional Resources:

NCBI RefSeq record:
XM_006504399.1
NBCI Gene record:
Por (18984)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042142 CGGAGGCACATCCTAGCCATT pLKO.1 1360 CDS 100% 1.350 1.080 N Por n/a
2 TRCN0000351493 CGGAGGCACATCCTAGCCATT pLKO_005 1360 CDS 100% 1.350 1.080 N Por n/a
3 TRCN0000042139 CGGGAAGGAACATTATTGTAT pLKO.1 317 CDS 100% 5.625 3.938 N Por n/a
4 TRCN0000334659 CGGGAAGGAACATTATTGTAT pLKO_005 317 CDS 100% 5.625 3.938 N Por n/a
5 TRCN0000042138 GCTCGAAATATGGCCAAAGAT pLKO.1 1987 CDS 100% 5.625 3.938 N Por n/a
6 TRCN0000323414 GCTCGAAATATGGCCAAAGAT pLKO_005 1987 CDS 100% 5.625 3.938 N Por n/a
7 TRCN0000042141 CCTGACCTACTGGTTCATCTT pLKO.1 201 CDS 100% 4.950 3.465 N Por n/a
8 TRCN0000334742 CCTGACCTACTGGTTCATCTT pLKO_005 201 CDS 100% 4.950 3.465 N Por n/a
9 TRCN0000042140 GCATCTAATGCACCTGGAATT pLKO.1 984 CDS 100% 0.000 0.000 N Por n/a
10 TRCN0000351532 GCATCTAATGCACCTGGAATT pLKO_005 984 CDS 100% 0.000 0.000 N Por n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.