Transcript: Mouse XM_006504596.2

PREDICTED: Mus musculus stromal antigen 3 (Stag3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stag3 (50878)
Length:
4593
CDS:
518..4240

Additional Resources:

NCBI RefSeq record:
XM_006504596.2
NBCI Gene record:
Stag3 (50878)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229571 CTTAATGCGCCATCGCTTTAT pLKO_005 4433 3UTR 100% 13.200 18.480 N Stag3 n/a
2 TRCN0000127057 CGAATAGTATCTAGTGGGAAT pLKO.1 806 CDS 100% 4.050 5.670 N Stag3 n/a
3 TRCN0000127055 CCGAATAGTATCTAGTGGGAA pLKO.1 805 CDS 100% 2.640 3.696 N Stag3 n/a
4 TRCN0000127058 CCCACATTTCAGAGTCTACTT pLKO.1 2835 CDS 100% 4.950 3.960 N Stag3 n/a
5 TRCN0000229570 AGCCTTGACTCTGGTATATTT pLKO_005 2794 CDS 100% 15.000 10.500 N Stag3 n/a
6 TRCN0000218825 CACCTAACGGAAGAGTTTAAT pLKO_005 1049 CDS 100% 15.000 10.500 N Stag3 n/a
7 TRCN0000229568 CTAACGAAGACAGCGACTTTG pLKO_005 696 CDS 100% 10.800 7.560 N Stag3 n/a
8 TRCN0000127054 CTTTCTGAAGTGGGTGCTATA pLKO.1 4387 3UTR 100% 10.800 7.560 N Stag3 n/a
9 TRCN0000127056 GCTAATGACTTCTCTGGTAAA pLKO.1 1285 CDS 100% 10.800 7.560 N Stag3 n/a
10 TRCN0000229569 GGTGGATGAGTGGCTAGATAA pLKO_005 904 CDS 100% 13.200 7.920 N Stag3 n/a
11 TRCN0000144651 GAAGAAGATGAGGAAGAAGAA pLKO.1 4100 CDS 100% 4.950 2.475 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.