Transcript: Mouse XM_006504659.3

PREDICTED: Mus musculus platelet derived growth factor, alpha (Pdgfa), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdgfa (18590)
Length:
1917
CDS:
422..1057

Additional Resources:

NCBI RefSeq record:
XM_006504659.3
NBCI Gene record:
Pdgfa (18590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339544 TTCGCAGGAAGAGAAGTATTG pLKO_005 666 CDS 100% 10.800 15.120 N Pdgfa n/a
2 TRCN0000065691 CTCTTGGAGATAGACTCCGTA pLKO.1 560 CDS 100% 2.640 3.696 N Pdgfa n/a
3 TRCN0000022333 CAAGACCAGGACGGTCATTTA pLKO.1 709 CDS 100% 13.200 9.240 N LOC377602 n/a
4 TRCN0000339543 CAAGACCAGGACGGTCATTTA pLKO_005 709 CDS 100% 13.200 9.240 N Pdgfa n/a
5 TRCN0000339547 CCATGGGTCCCATGCCATTAA pLKO_005 616 CDS 100% 13.200 9.240 N Pdgfa n/a
6 TRCN0000339473 GACATTCCTGAACATACTATG pLKO_005 1128 3UTR 100% 10.800 7.560 N Pdgfa n/a
7 TRCN0000339545 TCCAGCGACTCTTGGAGATAG pLKO_005 552 CDS 100% 10.800 7.560 N Pdgfa n/a
8 TRCN0000065692 CATTCGCAGGAAGAGAAGTAT pLKO.1 664 CDS 100% 5.625 3.938 N Pdgfa n/a
9 TRCN0000065689 AGGACGGTCATTTACGAGATA pLKO.1 716 CDS 100% 4.950 3.465 N Pdgfa n/a
10 TRCN0000065690 AGTGGAGTATGTCAGGAAGAA pLKO.1 883 CDS 100% 4.950 3.465 N Pdgfa n/a
11 TRCN0000065688 AGAAGTATTGAGGAAGCCATT pLKO.1 677 CDS 100% 4.050 2.835 N Pdgfa n/a
12 TRCN0000158260 CAGGACGGTCATTTACGAGAT pLKO.1 715 CDS 100% 4.050 2.835 N PDGFA n/a
13 TRCN0000022330 AGGACGGTCATTTACGAGATT pLKO.1 716 CDS 100% 4.950 3.465 N LOC377602 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.