Transcript: Mouse XM_006504691.3

PREDICTED: Mus musculus trinucleotide repeat containing 18 (Tnrc18), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnrc18 (231861)
Length:
9410
CDS:
777..9410

Additional Resources:

NCBI RefSeq record:
XM_006504691.3
NBCI Gene record:
Tnrc18 (231861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256219 AGCGGATGTTTGCTATGAAAT pLKO_005 4891 CDS 100% 13.200 18.480 N Tnrc18 n/a
2 TRCN0000256218 TCACGACTCCTCATCTGATTT pLKO_005 5303 CDS 100% 13.200 18.480 N Tnrc18 n/a
3 TRCN0000217930 GCGGATGTTTGCTATGAAATC pLKO.1 4892 CDS 100% 10.800 15.120 N Tnrc18 n/a
4 TRCN0000198608 CGCGTGAACTGAACTCCAATA pLKO.1 4840 CDS 100% 10.800 8.640 N Tnrc18 n/a
5 TRCN0000181383 CAGGCCCTGTTCACAGATATT pLKO.1 3705 CDS 100% 13.200 9.240 N Tnrc18 n/a
6 TRCN0000177960 GCGTGAACTGAACTCCAATAA pLKO.1 4841 CDS 100% 13.200 9.240 N Tnrc18 n/a
7 TRCN0000256222 CAGATAGAACTACCGAGTAAG pLKO_005 4176 CDS 100% 10.800 7.560 N Tnrc18 n/a
8 TRCN0000256221 TGCTGACATCAGACGACTATG pLKO_005 5179 CDS 100% 10.800 7.560 N Tnrc18 n/a
9 TRCN0000178435 GACGAAGACTTCCTGAAGAAT pLKO.1 5712 CDS 100% 5.625 3.938 N Tnrc18 n/a
10 TRCN0000181586 GCACCATGAAACCTGAACCTA pLKO.1 2347 CDS 100% 3.000 2.100 N Tnrc18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.