Transcript: Mouse XM_006504698.2

PREDICTED: Mus musculus diacylglycerol lipase, beta (Daglb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Daglb (231871)
Length:
2834
CDS:
405..2033

Additional Resources:

NCBI RefSeq record:
XM_006504698.2
NBCI Gene record:
Daglb (231871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176478 CTGAACTTTAAGACAACAGAT pLKO.1 2597 3UTR 100% 4.950 3.465 N Daglb n/a
2 TRCN0000198882 GCCAGAGACATAGAGTACGAT pLKO.1 960 CDS 100% 3.000 2.100 N Daglb n/a
3 TRCN0000178565 CCTCAGGAAACTGAGTTAGAT pLKO.1 819 CDS 100% 0.563 0.394 N Daglb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.