Transcript: Mouse XM_006504712.1

PREDICTED: Mus musculus sidekick cell adhesion molecule 1 (Sdk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sdk1 (330222)
Length:
10150
CDS:
353..6739

Additional Resources:

NCBI RefSeq record:
XM_006504712.1
NBCI Gene record:
Sdk1 (330222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113664 CCAGGGTTATAAGGTTTACTA pLKO.1 5305 CDS 100% 5.625 4.500 N Sdk1 n/a
2 TRCN0000113662 CGAGGACATCTGCAACAAATA pLKO.1 6397 CDS 100% 13.200 9.240 N Sdk1 n/a
3 TRCN0000113660 GCATTGTTGAACCAGAGTATT pLKO.1 7582 3UTR 100% 13.200 9.240 N Sdk1 n/a
4 TRCN0000113663 CCCTACACACACTACAGGTTT pLKO.1 3521 CDS 100% 4.950 3.465 N Sdk1 n/a
5 TRCN0000113661 GCTCCAGAATTGTGGTGGAAA pLKO.1 1965 CDS 100% 4.950 3.465 N Sdk1 n/a
6 TRCN0000240405 TCATCCTCCTGGTGGTCTTTG pLKO_005 6165 CDS 100% 10.800 5.400 Y LOC100047704 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.