Transcript: Mouse XM_006504754.3

PREDICTED: Mus musculus ubiquitin specific peptidase 42 (Usp42), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp42 (76800)
Length:
6256
CDS:
1233..5207

Additional Resources:

NCBI RefSeq record:
XM_006504754.3
NBCI Gene record:
Usp42 (76800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200130 CGGAGGTATGAGACTCTAGAA pLKO.1 4740 CDS 100% 4.950 6.930 N Usp42 n/a
2 TRCN0000217120 CCCAATGGAGAGCCAATTATT pLKO.1 2268 CDS 100% 15.000 12.000 N Usp42 n/a
3 TRCN0000182852 CGTCCTGCTAAATGGTGCTAA pLKO.1 3185 CDS 100% 4.950 3.960 N Usp42 n/a
4 TRCN0000182627 GCTACCTAAGATCCCGAGTTA pLKO.1 1936 CDS 100% 4.950 3.960 N Usp42 n/a
5 TRCN0000177340 GCTTCTTTAGTACATACTGTA pLKO.1 5320 3UTR 100% 4.950 3.960 N Usp42 n/a
6 TRCN0000215514 GACATAACGTTGGAGATTAAG pLKO.1 2004 CDS 100% 13.200 9.240 N Usp42 n/a
7 TRCN0000197613 CCTTATTCCAAACGGATACTT pLKO.1 5418 3UTR 100% 5.625 3.938 N Usp42 n/a
8 TRCN0000178218 GAAAGGTGATACAGCTGAGAA pLKO.1 3743 CDS 100% 4.950 3.465 N Usp42 n/a
9 TRCN0000350777 CATCTCAAATGCTGCTTAATT pLKO_005 5509 3UTR 100% 15.000 10.500 N USP42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.