Transcript: Mouse XM_006504825.3

PREDICTED: Mus musculus lemur tyrosine kinase 2 (Lmtk2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lmtk2 (231876)
Length:
8176
CDS:
304..4716

Additional Resources:

NCBI RefSeq record:
XM_006504825.3
NBCI Gene record:
Lmtk2 (231876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367993 AGTCATAGTGAAGGAGTTAAA pLKO_005 789 CDS 100% 13.200 18.480 N Lmtk2 n/a
2 TRCN0000196626 GACCCAGAAATAGACTTTAAG pLKO.1 511 CDS 100% 13.200 18.480 N LMTK2 n/a
3 TRCN0000023334 CCAGAATTAGTGACCAGCTTT pLKO.1 1228 CDS 100% 4.950 6.930 N Lmtk2 n/a
4 TRCN0000023337 CGACCTTCAAACAGAACTCAA pLKO.1 2472 CDS 100% 4.950 6.930 N Lmtk2 n/a
5 TRCN0000367997 TATTGTACAGCATCGTAAATT pLKO_005 5154 3UTR 100% 15.000 10.500 N Lmtk2 n/a
6 TRCN0000023335 CCCATCCTTGTGAATGATATT pLKO.1 2911 CDS 100% 13.200 9.240 N Lmtk2 n/a
7 TRCN0000360933 TTCGATGATGTCACCGTTTAT pLKO_005 4282 CDS 100% 13.200 9.240 N Lmtk2 n/a
8 TRCN0000023338 CCTGTCTTACTCCAGCATGTT pLKO.1 1788 CDS 100% 4.950 3.465 N Lmtk2 n/a
9 TRCN0000023336 CCCATCATTGTCAGTAACGAT pLKO.1 4162 CDS 100% 3.000 2.100 N Lmtk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.