Transcript: Mouse XM_006504955.2

PREDICTED: Mus musculus protection of telomeres 1A (Pot1a), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pot1a (101185)
Length:
2950
CDS:
566..2311

Additional Resources:

NCBI RefSeq record:
XM_006504955.2
NBCI Gene record:
Pot1a (101185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504955.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071252 GTCTACGATAACCACGTTCAA pLKO.1 1052 CDS 100% 4.950 6.930 N Pot1a n/a
2 TRCN0000071248 GCGACGAATTTGCTACCAGAT pLKO.1 2257 CDS 100% 4.050 5.670 N Pot1a n/a
3 TRCN0000071250 CTCCGTATGTTAGCAAAGGAA pLKO.1 489 5UTR 100% 3.000 4.200 N Pot1a n/a
4 TRCN0000071249 CCTAAATGTCATTCAGTACAA pLKO.1 1553 CDS 100% 4.950 3.465 N Pot1a n/a
5 TRCN0000071251 CCTGCTTCAAGTGAATGTCTA pLKO.1 1742 CDS 100% 4.950 3.465 N Pot1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504955.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.